Primer sequences for the Real-Time RT PCR analysis. | Download Table
Frontiers | Rapid whole genome sequencing methods for RNA viruses
![Sequences of T7 and SP6 promotor on pGEM-T Easy vector [15] | Download Scientific Diagram](https://www.researchgate.net/publication/342127777/figure/fig1/AS:1067600981291008@1631547317634/Sequences-of-T7-and-SP6-promotor-on-pGEM-T-Easy-vector-15.jpg "Sequences of T7 and SP6 promotor on pGEM-T Easy vector [15] | Download Scientific Diagram")
Sequences of T7 and SP6 promotor on pGEM-T Easy vector [15] | Download Scientific Diagram
MultiFRAGing: Rapid and Simultaneous Genotyping of Multiple Alleles in a Single Reaction | Scientific Reports
A Simple and Efficient Method for Assembling TALE Protein Based on Plasmid Library | PLOS ONE
cDNA library construction from a small amount of RNA: adaptor-ligation approach for two-round cRNA amplification using T7 and SP6 RNA polymerases | BioTechniques
IJMS | Free Full-Text | Method for Rapid Analysis of Mutant RNA Polymerase Activity on Templates Containing Unnatural Nucleotides
Mutational Analysis and Structure of the Phage SP6 Promoter - ScienceDirect
T7 Promoter - an overview | ScienceDirect Topics
The Length of Promoter Sequence Affects The De Novo Initiation By T7 RNA Polymerase in Vitro: New Insights Into The Evolution of Promoters For Single Subunit RNA Polymerases | bioRxiv
Maximizing transcription of nucleic acids with efficient T7 promoters | Communications Biology
Nonradioactive In Situ Hybridization: Optimization for Tissue Sections from Pregnant Uteri and Placenta during the First Half of Pregnancy - ScienceDirect
Addgene: SP6-VEE-IRES-Puro
Untitled
pBAT series of vectors – Hyvönen Group @ Biochemistry, Cambridge
Table SI. Primers used in the NRAS sequencing. Primer name Primer sequence NRAS exon2 forward primer CAACAGGTTCTTGCTGGTGT NRAS e
Addgene: pAC-SP6
2 pGEM-T EASY plasmid vector showing T7 and SP6 primer locations. | Download Scientific Diagram
SP6 RNA Polymerase Promoter Sequencing Primer
Addgene: SP6-hCas9-Ce-mRNA
List of primers used for DNA sequencing | Download Scientific Diagram
Making RNA probes with T7 transcription - OpenWetWare
Frontiers | Klebsiella Phage KP34 RNA Polymerase and Its Use in RNA Synthesis
HiScribe® SP6 RNA Synthesis Kit | NEB
Sequence of forward and reverse primers used in this study. | Download Table
